19 czerwca 2021

Ocenzurowane.pl

Wiadomości bez cenzury

COVID19 – dowody globalnego oszustwa

COVID-19 i późniejsze reakcje rządu wydają się być częścią międzynarodowego spisku mającego na celu popełnienie oszustwa. Wydaje się, że nie ma dowodów na to, że wirus o nazwie SARS-CoV-2 wywołuje chorobę zwaną COVID-19.

Czasami musisz kierować się instynktem. Nie jestem ekspertem w dziedzinie genetyki i, jak zawsze, oczekuję poprawy. Jednak moją uwagę zwróciły niektóre badania opublikowane przez hiszpańskie czasopismo medyczne D-Salud-Discovery. Ich rada doradcza złożona z wybitnie wykwalifikowanych lekarzy i naukowców nadaje ich badaniom wiarygodność. Ich twierdzenie jest zdumiewające.

Genetyczne startery i sondy używane w testach RT-PCR do identyfikacji SARS-CoV-2 nie są ukierunkowane na nic konkretnego. Postępowałem zgodnie z technikami wyszukiwania przedstawionymi w tym angielskim tłumaczeniu ich raportu i mogę potwierdzić dokładność ich twierdzeń dotyczących sekwencji nukleotydów wymienionych w protokołach Światowej Organizacji Zdrowia. Możesz zrobić to samo.

D-Salud-Discovery oświadcza, że nie ma testów zdolnych do identyfikacji SARS-CoV-2. W związku z tym wszystkie twierdzenia dotyczące domniemanego wpływu COVID 19 na zdrowie populacji są bezpodstawne.

Cała oficjalna narracja COVID 19 jest oszustwem. Podobno nie ma naukowych podstaw dla jakiejkolwiek części tej narracji.

Jeśli te twierdzenia są trafne, możemy stwierdzić, że nie ma dowodów na pandemię, a jedynie jej złudzenie. Ponieśliśmy nieobliczalne straty bez wyraźnego powodu, poza ambicjami pozbawionych skrupułów despotów, którzy chcą przekształcić globalną gospodarkę i nasze społeczeństwo, aby odpowiadały ich celom.

Czyniąc to, ta „klasa pasożytów” potencjalnie popełniła niezliczone przestępstwa. Przestępstwa te mogą i powinny być przeanalizowane i rozpatrzone przed sądem.

Identyfikacja ale czego dokładnie?

Światowa Organizacja Zdrowia (WHO) sklasyfikowała COVID-19 (choroba COronaVIrus 2019). Ogłosili globalną pandemię COVID-19 11 marca 2019 roku.

Wytyczne WHO dotyczące badań laboratoryjnych stanowią:

Czynnik etiologiczny [przyczyna choroby] odpowiedzialny za skupisko przypadków zapalenia płuc w Wuhan został zidentyfikowany jako nowy betakoronawirus (z tej samej rodziny co SARS-CoV i MERS-CoV) poprzez sekwencjonowanie nowej generacji (NGS) z hodowanego wirusa lub bezpośrednio z próbek otrzymanych od kilku pacjentów z zapaleniem płuc.”

WHO twierdzi, że wirus SARS CoV-2 jest powodem choroby COVID-19. Twierdzą również, że ten wirus został wyraźnie zidentyfikowany przez naukowców z Wuhan.

W WHO’wskim Novel Coronavirus 2019-nCov Situation Report 1 na temat koronawirusa 2019-nCov 1 stwierdza się:

Chińskie władze zidentyfikowały nowy typ koronawirusa, który został wyizolowany 7 stycznia 2020 r. …… W dniu 12 stycznia 2020 r. Chiny udostępniły krajom sekwencję genetyczną nowego koronawirusa do wykorzystania przy opracowywaniu określonych zestawów diagnostycznych.”

Te dwa oświadczenia WHO jasno sugerują, że wirus SARS-CoV-2 został wyizolowany (co oznacza oczyszczony do badań), a następnie zidentyfikowano sekwencje genetyczne z wyizolowanej próbki. Na tej podstawie opracowano i rozprowadzono na całym świecie zestawy diagnostyczne do testowania wirusa w miastach i społecznościach na całym świecie. Według WHO i chińskich naukowców testy te wykryją wirusa, który powoduje COVID 19.

Jednak WHO stwierdza również:

Pracując bezpośrednio na podstawie informacji o sekwencjach, zespół opracował serię testów amplifikacji genów (PCR) wykorzystywanych przez laboratoria.”

Naukowcy z Wuhan opracowali testy amplifikacji genów na podstawie „informacji o sekwencji”, ponieważ nie było wyizolowanej, oczyszczonej próbki tak zwanego wirusa SARS-CoV-2. Pokazali również obrazy z mikroskopu elektronowego nowo odkrytych wirionów (kolczastej kulki białkowej zawierającej wirusowe RNA).

Jednak takie struktury białek nie są wyjątkowe. Wyglądają jak inne okrągłe pęcherzyki, takie jak pęcherzyki endocytarne i egzosomy.

Wirusolodzy twierdzą, że nie jest możliwe „wyizolowanie” wirusa, ponieważ replikuje się on tylko w komórkach gospodarza. Dodają, że Postulaty Kocha nie mają zastosowania, ponieważ dotyczą bakterii (czyli organizmów żywych). Zamiast tego wirusolodzy obserwują cytopatogenne skutki wirusa (CPE), powodujące mutację i degradację komórek w hodowlach komórkowych.

Kiedy chińscy naukowcy po raz pierwszy zsekwencjonowali pełny genom SARS-CoV-2, zaobserwowali CPE w komórkach Vero E6 i Huh7. Vero E6 to unieśmiertelniona linia komórek małpich, a Huh7 to unieśmiertelnione komórki rakowe (rakotwórcze). Oznacza to, że były one utrzymywane in vitro (w hodowlach na płytkach Petriego) przez wiele lat.

Centralnym punktem oficjalnej historii SARS-CoV-2 jest idea, że ​​jest to wirus odzwierzęcy, zdolny do pokonywania dystansu między zwierzętami a ludźmi. Kiedy naukowcy z amerykańskiego CDC „zainfekowali” różne komórki nowym wirusem, zauważyli, co następuje:

Zbadaliśmy zdolność SARS-CoV-2 do infekowania i replikacji w kilku popularnych liniach komórkowych naczelnych i ludzkich, w tym ludzkich komórkach gruczolakoraka (A549) [komórki płuc], ludzkich komórkach wątroby (HUH7.0) i ludzkich embrionalnych komórkach nerkowych ( HEK-293T), oprócz Vero E6 i Vero CCL81 [komórki małpy]… Nie zaobserwowano efektu cytopatycznego w żadnej z linii komórkowych z wyjątkiem komórek Vero [komórki małpy]… Komórki HUH7.0 i 293T wykazały jedynie niewielką replikację wirusa i Komórki A549 [ludzkie komórki tkanki płucnej] były niezgodne z zakażeniem SARS-CoV-2”.

CDC nie zaobserwował żadnego CPE w ludzkich komórkach. Nie widzieli żadnych dowodów na to, że ten rzekomy wirus spowodował jakąkolwiek chorobę człowieka. Ten rzekomy ludzki wirus nie wykazywał też żadnej godnej uwagi replikacji w ludzkich komórkach, co sugeruje, że infekcja z człowieka na człowieka byłaby niemożliwa.

Dostrzegając ten problem, zespół polskich naukowców wprowadził tego sekwencjonowanego „wirusa” do komórek nabłonka ludzkiego (dróg oddechowych). Obserwowali wpływ na te kultury HAE przez 5 dni. Zauważyli znacznie większą replikację niż naukowcy z CDC, ale ostatecznie stwierdzili:

„Nie zaobserwowaliśmy żadnego uwolnienia wirusa z podstawno-bocznej strony hodowli HAE”.

Oznacza to, że nie widzieli żadnych dowodów rzekomych wirionów naruszających błonę ściany komórkowej. Ponownie sugerujemy, że ten tak zwany wirus nie jest zaraźliwy dla ludzi.

Nie jest jasne, czy SARS-CoV-2 jest ludzkim wirusem zdolnym do wywoływania choroby. Może nawet nie istnieć fizycznie. Czy to nic innego jak koncepcja oparta na predykcyjnych sekwencjach genetycznych?

Podróż odkrywcza

Wuhan Center for Disease Control and Prevention oraz Shanghai Public Health Clinical Center opublikowały pierwszy pełny genom SARS-CoV-2 (MN908947.1). To było wielokrotnie aktualizowane. Jednak MN908947.1 był pierwszą sekwencją genetyczną opisującą rzekomy czynnik etiologiczny COVID-19 (SARS-CoV-2).

Wszystkie kolejne roszczenia, testy, terapie, statystyki, opracowywanie szczepionek i wynikające z nich zasady są oparte na tej sekwencji. Jeśli testy tego nowego wirusa nie zidentyfikują niczego, co mogłoby wywołać chorobę u ludzi, cała narracja COVID-19 jest niczym innym jak farsą.

Badacze z Wuhan, stwierdzili, że już skutecznie poskładali sekwencję genetyczną SARS CoV-2, przez dopasowwanie fragmentów znajdujących się w próbkach zawierających inne, uprzednio odkryte, sekwencje genetyczne. Z zebranych materiałów stwierdzili, że 87,1% pasuje do koronawirusa SARS (SARS-Cov). Zastosowali de novo assembly i ukierunkowaną reakcję PCR i znaleźli 29 891 par zasad, które w 79,6% są zgodne z SARS-CoV.

Musieli użyć de novo assembly,  ponieważ nie mieli wiedzy a priori o prawidłowej kolejności lub kolejności tych fragmentów. Po prostu stwierdzenie WHO, że chińscy naukowcy wyizolowali wirusa 7 stycznia, jest fałszywe.

Zespół z Wuhan wykorzystał 40 rund amplifikacji RT-qPCR, aby dopasować fragmenty cDNA (uzupełniające się DNA zbudowane z fragmentów RNA z próbek) z opublikowanym genomem koronawirusa SARS (SARS-CoV). Niestety nie jest jasne, jak dokładny jest oryginalny genom SARS-CoV.

W 2003 roku zespół naukowców z Hongkongu przebadał 50 pacjentów z ciężkim ostrym zespołem oddechowym (SARS). Pobrali próbki od 2 z tych pacjentów i opracowali hodowlę w komórkach wątroby płodu małpy.

Stworzyli 30 klonów znalezionego materiału genetycznego. Nie mogąc znaleźć dowodów na istnienie żadnego innego znanego wirusa, tylko w jednej z tych sklonowanych próbek znaleźli sekwencje genetyczne „nieznanego pochodzenia”.

Badając te nieznane sekwencje RNA, stwierdzili, że 57% pasują do bydlęcego koronawirusa i mysiego wirusa zapalenia wątroby i wywnioskowali, że należy do rodziny Coronaviridae. Biorąc pod uwagę te sekwencje, aby sugerować nowo odkryty wirus SARS-CoV (nowe odkrycie to ambrozja dla naukowców), zaprojektowali startery RT-PCR do testowania tego nowego wirusa. Naukowcy stwierdzili:

Startery do wykrywania nowego wirusa zaprojektowano do wykrywania RT-PCR tego genomu koronawirusa związanego z zapaleniem płuc u ludzi w próbkach klinicznych. Spośród 44 próbek z jamy nosowo-gardłowej dostępnych od 50 pacjentów z SARS, 22 miało dowody na obecność RNA koronawirusa związanego z zapaleniem płuc u ludzi.”

Połowa badanych pacjentów, którzy mieli te same objawy, uzyskała wynik pozytywny dla tego nowego rzekomego wirusa. Nikt nie wie, dlaczego druga połowa uzyskała wynik negatywny na obecność tego nowego wirusa SARS-CoV. Takie pytanie nie padło.

Ten rzekomy wirus miał tylko 57% dopasowanie sekwencji do rzekomo znanego koronawirusa. Pozostałe 43% „tam” po prostu było. Zsekwencjonowane dane zostały wyprodukowane i zapisane jako nowy genom GenBank Accession No. AY274119.

Naukowcy z Wuhan następnie znaleźli 79,6% dopasowania sekwencji do AY274119 i dlatego nazwali go nowym szczepem SARS-CoV (2019-nCoV – ostatecznie przemianowanym na SARS-CoV-2). Nikt na żadnym etapie tego procesu nie wyprodukował żadnej wyizolowanej, oczyszczonej próbki żadnego wirusa. Jedyne, co mieli, to dopasowania sekwencji procentowej do innych dopasowań sekwencji procentowej.

Nic nie wyizolowano

Naukowcy są bardzo zirytowani, ponieważ wciąż mówią, że wirus został wyizolowany, ale nikt im nie wierzy. Dzieje się tak, ponieważ jak dotąd nikt nie dostarczył ani jednej oczyszczonej próbki wirusa SARS-CoV-2. Zamiast tego mamy kompletny genom i, jak za chwilę odkryjemy, nie jest to szczególnie przekonujące.

Dziennikarze śledczy Torsten Engelbrecht i Konstantin Demeter poprosili niektórych naukowców, którzy twierdzili, że mają zdjęcia wirionów SARS-C0V-2, aby potwierdzili, że są to obrazy izolowanego, oczyszczonego wirusa. Żaden z nich tego nie zrobił.

W Australii naukowcy z Instytutu Doherty ogłosili, że wyizolowali  wirusa SARS-CoV-2. Poproszeni o wyjaśnienie naukowcy powiedzieli:

„Mamy krótkie (RNA) sekwencje z testu diagnostycznego, które można wykorzystać w testach diagnostycznych”

To wyjaśnia, dlaczego rząd Australii oświadczył:

Wiarygodność testów COVID-19 jest niepewna ze względu na ograniczoną bazę dowodów… Dostępne są ograniczone dowody pozwalające ocenić dokładność i użyteczność kliniczną dostępnych testów COVID-19”.

W Wielkiej Brytanii w lipcu grupa zaniepokojonych naukowców napisała list do premiera Wielkiej Brytanii Borisa Johnsona, w którym poprosili go o aby:

Przedstawić niezależnie recenzowane dowody naukowe potwierdzające, że wirus Covid-19 został wyizolowany.”

Do tej pory nie otrzymali odpowiedzi.

Podobnie brytyjski badacz Andrew Johnson złożył wniosek o wolność informacji do Public Health England (PHE). Poprosił ich o dostarczenie mu swoich danych opisujących izolację wirusa SARS-COV-2. Na co  odpowiedzieli:

PHE może potwierdzić, że nie zawiera informacji w sposób sugerowany w Twojej prośbie”.

Kanadyjska badaczka Christine Massey wystąpiła z podobną prośbą o ujawnienie informacji, prosząc o to samo kanadyjski rząd. Na co odpowiedział rząd Kanady:

Po dokładnym wyszukiwaniu z przykrością informujemy, że nie mogliśmy znaleźć żadnych danych odpowiadających na Państwa żądanie”.

 CDC w USA oświadczyło w RT-PCR Diagnostic Panel:

… Obecnie nie są dostępne ilościowo określone izolaty wirusa 2019-nCoV …… ..Wykrycie wirusowego RNA może nie wskazywać na obecność zakaźnego wirusa lub że 2019-nCoV jest czynnikiem wywołującym objawy kliniczne.”

Ostatnia aktualizacja 13 lipca 2020 r., CDC jeszcze nie pozyskała czystej próbki wirusa od jakiegokolwiek pacjenta, u którego stwierdzono chorobę COVID-19. Otwarcie przyznają, że ich testy niekoniecznie pokazują, czy SARS-CoV-2 jest obecny lub powoduje COVID 19.

Powiedziano nam, że nic z tego nie ma znaczenia. Że jesteśmy ignorantami i po prostu nie rozumiemy wirusologii. Dlatego musimy przyjąć obrazy rzeczy, o których wiemy, że mogą być czymś innym, a sekwencje genetyczne (które mogą być czymś innym) jako ostateczny dowód, że ten wirus i choroba, którą ma wywoływać, są prawdziwe.

Testowanie po nic

WHO i każdy rząd, think tank, komitet sterujący polityką, rządowy doradca naukowy, instytucje ponadnarodowe i inne osoby, które promują oficjalną narrację o COVID-19, zapewniają, że SARS-CoV-2 powoduje COVID-19.

Chociaż nikt nigdy nie wyprodukował próbki tego rzekomego wirusa, rzekomy genom SARS-CoV-2 został opublikowany. Jest w domenie publicznej.

Mówi się, że kluczowe sekwencje genetyczne w genomie SARS-CoV-2 mają określone funkcje. Są to białka docelowe, które naukowcy badają, aby zidentyfikować obecność „wirusa”. Obejmują one:

  • Gen polimerazy RNA (Rd-Rp) – umożliwia replikację RNA SARS-CoV-2 w cytoplazmie komórek nabłonka chorych na COVID-19.
  • Gen S (Orf2) – ta glikoproteina tworzy kolec na powierzchni wirionu SARS-CoV-2, który rzekomo ułatwia wiązanie SARS-CoV-2 z receptorami ACE2 na komórkach, umożliwiając RNA wewnątrz powłoki białka wirionu (kapsyd) przejście do teraz zainfekowanej komórki.
  • Gen E (Orf1ab) – małe białko błonowe używane w składaniu wirusa
  • Gen N (Orf9a) – gen nukleokapsydu, który wiąże RNA podczas tworzenia kapsydu

WHO prowadzi publicznie dostępny rejestr starterów RT-PCR i sond używanych do testowania SARS-CoV-2. Startery to specyficzne sekwencje nukleotydowe, które wiążą się (łączą) z nicią antysensowną i sensowną zsyntetyzowanego cDNA (nazywane odpowiednio starterami do przodu i do tyłu).

Nici cDNA rozdzielają się po podgrzaniu i przekształcają po schłodzeniu. Przed schłodzeniem sekwencje nukleotydowe zwane sondami są wprowadzane do hybrydyzacji z określonymi regionami docelowymi podejrzanego genomu wirusa. Podczas amplifikacji, gdy obszary między starterami wydłużają się, gdy starter uderza w sondę, sonda rozpada się, uwalniając fluorescent lub barwnik, który następnie może zostać odczytany przez naukowców.

Naukowcy twierdzą, że to identyfikacja tych markerów dowodzi obecności SARS-CoV-2 w próbce.

Coś innego, co jest publicznie dostępne, to podstawowe narzędzie wyszukiwania lokalnego dopasowania (BLAST). Dzięki temu każdy może porównać opublikowane sekwencje nukleotydów ze wszystkimi zapisanymi w genetycznej bazie danych National Institutes of Health (NIH) Stanów Zjednoczonych o nazwie GenBank. Dlatego możemy BLASTOWAĆ zastrzegane startery SARS-CoV-2, sondy i sekwencje genów docelowych.

Protokoły WHO do przodu i do tyłu oraz protokoły sondy dla rzekomego genomu wirusa SARS-CoV-2 opierają się na profilach genów RdRp, Orf1, N i E. Każdy może przeprowadzić je przez BLAST, aby zobaczyć, co znajdzie.

Istotną sekwencją nukleotydową RdRP, używaną jako starter do przodu, jest – ATGAGCTTAGTCCTGTTG. Jeśli przeprowadzimy nukleotydowy BLAST, jest to rejestrowane jako kompletny izolat SARS-CoV-2 ze 100% dopasowaną identycznością sekwencji. Podobnie, odwrotna sekwencja startera genu E – ATATTGCAGCAGTACGCACACA – ujawnia obecność sekwencji Orf1ab, która również identyfikuje SARS-CoV-2.

Jednak BLAST umożliwia także przeszukiwanie sekwencji nukleotydów genomów drobnoustrojów i człowieka. Jeśli szukamy sekwencji RdRp SARS-CoV-2, ujawnia ona 99 ludzkich chromosomów ze 100% zgodnością sekwencji. Orf1ab (gen E) zwraca 90 ze 100% identycznością sekwencji z ludzkimi chromosomami.

Robiąc to samo dla tych sekwencji, wyszukując mikroorganizmy, znajdziemy 92 drobnoustroje w 100% zgodne z genem SARS-CoV-2 E i 100 dopasowanych drobnoustrojów o 100% identyczności sekwencji z istotnym genem SARS-CoV-2 RdRp.

Ilekroć sprawdzamy tak zwane unikalne markery genetyczne dla SARS-CoV-2, zapisane w protokołach WHO, znajdujemy pełne lub wysokoprocentowe dopasowania z różnymi fragmentami ludzkiego genomu. Sugeruje to, że sekwencje genetyczne, które mają identyfikować SARS-CoV-2, nie są unikalne. Może to być wszystko, od sekwencji drobnoustrojów po fragmenty ludzkich chromosomów.

Tak zwane osoby weryfikujące fakty, takie jak  projekt Health Feedback firmy Reuters, szybko odrzuciły twierdzenia tych, którzy zauważyli widoczny brak specyficzności w rzekomym genomie SARS-CoV-2.

Używając mnóstwa słomianych argumentów, takich jak: „to twierdzenie sugeruje, że każdy test powinien być pozytywny” (a tak nie jest), ich próba obalenia wygląda mniej więcej tak:

Startery są zaprojektowane tak, aby wiązały się z określonymi sekwencjami nukleotydów, które są unikalne dla wirusa. Starter do przodu może wiązać się z określonym chromosomem, ale starter do tyłu nie wiąże się z tym samym chromosomem, więc chromosom nie jest obecny w wirusie SARS-CoV-2. Ponadto, ponieważ startery w przód i w tył otaczają sekwencję, która ma być amplifikowana, sekwencja cDMA między starterami jest unikalna dla wirusa.

Wydaje się to celowo przeinaczać znaczenie tych ustaleń, przedstawiając argument, którego nie wysuwa nikt oprócz samych weryfikatorów faktów. Przeszukiwania BLAST pokazują, że te sekwencje docelowe nie są unikalne dla SARS-CoV-2. Nie trzeba też znajdować wszystkich celów, aby wynik był pozytywny.

Marokańscy naukowcy zbadali epidemiologię rzekomych marokańskich przypadków SARS-CoV-2. Dziewięć procent było pozytywnych dla trzech genów, osiemnaście procent było pozytywnych dla dwóch genów, a siedemdziesiąt trzy procent dla jednego. Jak przed chwilą omówiliśmy, wiele mogło być pozytywnych dla żadnego.

Jest to całkowicie zgodne z wytycznymi dotyczącymi testów WHO. Stwierdzają:

„Optymalna diagnoza obejmuje NAAT [test amplifikacji kwasu nukleinowego] z co najmniej dwoma niezależnymi od genomu celami SARS-CoV-2; jednakże na obszarach, gdzie transmisja jest powszechna, można zastosować prosty algorytm pojedynczego celu… Jeden lub więcej negatywnych wyników niekoniecznie wyklucza zakażenie SARS-CoV-2.”

Bez względu na fałszywe argumenty dobrze finansowanych weryfikatorów faktów, jeśli startery do przodu i do tyłu identyfikują śmieci, być może jeden jest fragmentem chromosomu, a drugi sekwencją drobnoustrojów, wówczas wzmocniony region między nimi jest prawdopodobnie również śmieciami.

Argument, że RT-PCR znajduje tylko RNA, jest zwodniczy. Naturalna transkrypcja (oddzielenie nici DNA) zachodzi podczas ekspresji genów. Nikt nie mówi, że całe chromosomy lub mikroby są sekwencjonowane w rzekomym genomie SARS-CoV-2. Choć mogą, z tego, co wiemy. Mówią, że rzekome markery używane do testowania tego rzekomego wirusa nie nadają są odpowiednie.

Testy RT-PCR nie sekwencjonują całego genomu. Poszukują przypadków specyficznej fluorescencji sondy, aby wskazać obecność sekwencji, o których mówi się, że istnieją. Sekwencje te są zdefiniowane w MN908947.1 i kolejnych aktualizacjach. Te startery i sondy nie mogą ujawnić niczego poza dopasowaniami RNA wyekstrahowanymi z niekodującego, czasami nazywanego „śmieciowym” DNA (cDNA).

Na przykład gen SARS-CoV-2 S ma być wysoce specyficzny dla genomu wirusa SARS-CoV-2. Sekwencja docelowa to – TTGGCAAAATTCAAGACTCACTTTC. Wyszukiwanie mikrobiologiczne BLAST zwraca 97 dopasowań drobnoustrojów ze 100% zgodnością sekwencji. Najniższe dopasowanie procentowe tożsamości, w pierwszej setce, to 95%. Ludzki genom BLAST również znajduje 100% dopasowanie sekwencji do 86 fragmentów ludzkich chromosomów.

Bez względu na to, gdzie spojrzysz w rzekomym genomie SARS-CoV-2, w protokołach testowych WHO nie ma nic, co jasno identyfikuje, co to jest. Cały genom może być fałszywy. Testy nie dowodzą istnienia SARS-CoV-2. Odsłaniają jedynie zupę nieokreślonego materiału genetycznego.

Jeśli tak, ponieważ nie ma wyizolowanych ani oczyszczonych próbek wirusa bez wykonalnego testu, nie ma dowodów na istnienie SARS-CoV-2. Dlatego nie ma żadnych dowodów na istnienie choroby zwanej COVID-19.

Oznacza to, że nie ma podstaw naukowych do jakichkolwiek twierdzeń dotyczących liczby przypadków COVID-19, przyjęć do szpitali lub wskaźników śmiertelności. Wszystkie środki podjęte w celu zwalczania tego śmiercionośnego wirusa są prawdopodobnie oparte na niczym.

Ostateczne oszustwo

Oszustwo to przestępstwo. Prawną definicjią oszustwa jest:

„Jakaś podstępna praktyka lub umyślna sztuczka, której celem jest odebranie komuś prawa lub wyrządzenie mu krzywdy”.

Prawna definicja spisku to:

„Połączenie lub konfederacja między dwiema lub więcej osobami utworzonymi w celu popełnienia, wspólnym wysiłkiem, jakiegoś czynu niezgodnego z prawem lub przestępstwa”

Wydaje się, że ci, którzy twierdzą, że mamy do czynienia z pandemią, nie dostarczyli żadnych dowodów na to, że wirus o nazwie SARS-CoV-2 wywołuje chorobę zwaną COVID-19. Wszystkie informacje silnie sugerujące taką możliwość są łatwo dostępne w domenie publicznej. Każdy może to przeczytać.

Aby nastąpiło oszustwo, oszustwo musi być umyślne. Intencją musi być celowe pozbawienie innych ich praw lub zranienie ich w inny sposób. Jeśli istnieją dowody zmowy między osobami i organizacjami w celu popełnienia oszustwa, jest to spisek (w jurysdykcjach prawa zwyczajowego) lub wspólne przedsiębiorstwo przestępcze (JCE) na mocy prawa międzynarodowego.

Wygląda na to, że COVID-19 był celowo wykorzystywany jako casus belli do prowadzenia wojny z ludzkością. Zostaliśmy uwięzieni we własnych domach, nasza wolność przemieszczania się została ograniczona, wolność słowa i wypowiedzi została ograniczona, prawa do protestowania zostały ograniczone, oddzieloni od bliskich, firmy zniszczone, zbombardowani psychicznie, w kagańcach i terroryzowani.

Co gorsza, chociaż nie ma dowodów na bezprecedensową śmiertelność ze wszystkich przyczyn, odnotowano bezprecedensowy wzrost liczby zgonów. Są one ściśle powiązane z lockdownami, które doprowadziły do ​​wycofania świadczeń zdrowotnych, za które płacimy, i zmiany orientacji publicznych usług zdrowotnych na leczenie jednej domniemanej choroby z wyłączeniem wszystkich innych.

Ponadto ci, którzy przekazali historię COVID-19, sugerują, że ta domniemana choroba stanowi uzasadnienie dla całkowitej restrukturyzacji światowej gospodarki, naszych systemów politycznych, społeczeństw, kultur i samej ludzkości.

Dopuszczenie do udziału w ich tzw. „nowej normalności”,  która jest hurtowym przekształceniem całego naszego społeczeństwa bez naszej zgody, nalegają, abyśmy podporządkowali się ich warunkom.

Obejmują one między innymi biometryczny nadzór nad wszystkimi, scentralizowaną kontrolę i monitorowanie wszystkich naszych transakcji, opresyjne ograniczenia biznesowe i społeczne oraz skuteczne żądanie, abyśmy nie mieli prawa do suwerenności nad naszymi własnymi ciałami. Stanowi to warunek niewolnictwa.

Nie ma wątpliwości, że zostaliśmy pozbawieni naszych praw i zranieni. Dowody na to, że szkoda została celowo spowodowana przez międzynarodową konspirację, są przytłaczające. Niszczycielska polityka, prowadzona przez rządy na całym świecie, najwyraźniej wywodzi się z globalistycznych think tanków i ponadnarodowych instytucji na długo przed pojawieniem się tej nieistniejącej pandemii.

W jurysdykcjach Kodeksu Napoleona domniemywa się winy. Aby oskarżeni spiskowcy udowodnili swoją niewinność, muszą wykazać, że pomimo swoich niezmierzonych zasobów zbiorowo nie byli w stanie uzyskać dostępu ani zrozumieć żadnego z ogólnie dostępnych dowodów sugerujących, że COVID-19 jest mitem.

Osoby odpowiedzialne za przestępstwo spisku w celu popełnienia globalnego oszustwa powinny być sądzone. Jeśli zostaną uznani za winnych, powinni zostać uwięzieni, podczas gdy reszta z nas będzie próbowała naprawić szkody, które już wyrządzili.

image_pdfGeneruj PDFimage_printDrukuj